Detail of EST/Unigene JK496178 |
Acc. | JK496178 |
Internal Acc. | CSATR1JP-T3-021_K06_3DEC2008_021 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase OS=Malus domestica E-value=2e-94; Bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase OS=Pyrus communis E-value=5e-94; Dihydroflavonol-4-reductase OS=Vitis vinifera E-value=2e-88; Dihydroflavonol-4-reductase OS=Dianthus caryophyllus E-value=1e-84; Dihydroflavonol-4-reductase OS=Arabidopsis thaliana E-value=4e-83; |
Length | 649 nt |
Species | Cannabis sativa |
Belonged EST Libraries | LIBEST_027499; |
Sequence | ATATTGTGTAGGAAGGAGGAGGAGGAGTGATGGTGTCCAAAGGTGAAACCGTTTGTGTGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K07748 sterol-4alpha-carboxylate 3-dehydrogenase (decarboxylating) |
EC | 1.1.1.145 1.1.1.181 5.3.3.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834291 |
Trichome-related Gene from Literature | 834291 |