| Acc. |
JK500897 |
| Internal Acc. |
CSATR1JP_T3_017_F17_19DEC2008_075 |
| Type |
EST
|
| Annotation (Top 5 hits in Uniprot_trembl) |
Chalcone synthase OS=Arabidopsis thaliana E-value=1e-17; Chalcone synthase OS=Matthiola incana E-value=2e-17; Chalcone synthase OS=Dianthus monspessulanus E-value=2e-17; Chalcone synthase OS=Dianthus caryophyllus E-value=2e-17; Chalcone synthase OS=Arabis alpina E-value=3e-17; |
| Length |
174 nt |
| Species |
Cannabis sativa |
| Belonged EST Libraries |
LIBEST_027499; |
| Sequence |
GGCACCGCCAATCCGGAGAACATTTTAATACAAGATGAGTTTCCTGACTACTACTTTCGG
GTCACCAAAAGTGAACACATGACTCAACTCAAAGAAAAGTTTCGAAAAATATGTGATAAA
AGTATGATAAGGAAACGTAACTGTTTCTTAAATGAAGAACACCTAAAGTAAAAC
|
| EST members of Unigene |
N/A
|
| InterProScan Domain |
|
| Gene Ontology |
|
| KEGG Orthology |
|
| EC |
|
| Transcription Factor Family |
|
| Transporter Classification Family |
|
| Probeset |
|
| Corresponding NCBI Gene |
831241
|
| Trichome-related Gene from Literature |
831241
|