Detail of EST/Unigene JK501526 |
Acc. | JK501526 |
Internal Acc. | CSATR1JP_T3_1004_C05_14MAR2008_043 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Biotin carboxylase 1, chloroplastic OS=Populus trichocarpa E-value=0; Biotin carboxylase 2, chloroplastic OS=Populus trichocarpa E-value=0; Biotin carboxylase, chloroplastic OS=Arabidopsis thaliana E-value=4e-88; Biotin carboxylase OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=3e-51; Biotin carboxylase 1 OS=Bacillus subtilis (strain 168) E-value=2e-45; |
Length | 705 nt |
Species | Cannabis sativa |
Belonged EST Libraries | LIBEST_027499; |
Sequence | CTCTCCCTCCCTTGCTTCGCAAAACAATCGCTCTCCTCGGTCGCATTCCGCCAGCTATCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01965 propionyl-CoA carboxylase alpha chain; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K01965 propionyl-CoA carboxylase alpha chain; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K01968 3-methylcrotonyl-CoA carboxylase alpha subunit |
EC | 6.4.1.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833497 |
Trichome-related Gene from Literature | 833497 |