| Detail of EST/Unigene SRR015435.100949 |
| Acc. | SRR015435.100949 |
| Internal Acc. | EIOURYN01D1JXI |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA synthase 6 OS=Arabidopsis thaliana E-value=6e-11; 3-ketoacyl-CoA synthase 5 OS=Arabidopsis thaliana E-value=4e-10; 3-ketoacyl-CoA synthase 19 OS=Arabidopsis thaliana E-value=5e-08; 3-ketoacyl-CoA synthase 17 OS=Arabidopsis thaliana E-value=2e-07; 3-ketoacyl-CoA synthase 10 OS=Arabidopsis thaliana E-value=2e-07; |
| Length | 108 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGGGAGTTGGAGAAAACAAGCTACAGTTCACGACAAGAATATCGATATCTTTAGGCTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |