Detail of EST/Unigene SRR015435.108014
Acc. SRR015435.108014
Internal Acc. EIOURYN01ENXR5
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 4-hydroxy-3-methylbut-2-enyl diphosphate reductase, chloroplastic OS=Arabidopsis thaliana E-value=7e-09; 4-hydroxy-3-methylbut-2-enyl diphosphate reductase, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-08; 4-hydroxy-3-methylbut-2-enyl diphosphate reductase OS=Cyanothece sp. (strain PCC 7425 / ATCC 29141) E-value=6e-08; 4-hydroxy-3-methylbut-2-enyl diphosphate reductase OS=Cyanothece sp. (strain PCC 8801) E-value=1e-07; 4-hydroxy-3-methylbut-2-enyl diphosphate reductase OS=Synechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6) E-value=2e-07;
Length 97 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGTTCGTAAGTTTCAACACTATATGCGATGCCACACAAGAGCGTCAAGATGCAATGTA
TAAGCTGGTTGAGCAAAAGCTGGATCTTATGTTAGTG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A