Detail of EST/Unigene SRR015435.108642
Acc. SRR015435.108642
Internal Acc. EIOURYN01DFG9Q
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Catharanthus roseus E-value=6e-12; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=1e-11; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-10; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase OS=Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / LMG 4051 / NBRC 15346 / NCIMB 9279 / R1 / VKM B-1422) E-value=2e-06;
Length 115 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGCATGAGGAATATTAATCCCACCAATAATCAAAGGATAACCAGGTTCCAATCGATGA
AGGTCAAATCCATGGCCGACTCTAAAAGGAAGAGACTTCAACGGAGTGGAATTCG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A