Detail of EST/Unigene SRR015435.122474
Acc. SRR015435.122474
Internal Acc. EIOURYN01BE1LP
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=1e-12; 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-11; 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase OS=Protochlamydia amoebophila (strain UWE25) E-value=1e-09; 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase OS=Bacteroides vulgatus (strain ATCC 8482 / DSM 1447 / NCTC 11154) E-value=2e-07; 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase OS=Akkermansia muciniphila (strain ATCC BAA-835) E-value=2e-07;
Length 104 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGCCAATTCCGATTGCAGACTTCATCCTTCCATCCTCACCTTCACCAGCTTCAGTAAC
TCCCAAGTGTAAAGGATAATCCCATCCTTGAACATACATCTCNG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A