| Detail of EST/Unigene SRR015435.123003 |
| Acc. | SRR015435.123003 |
| Internal Acc. | EIOURYN01E0MTK |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Catalase OS=Vigna radiata var. radiata E-value=7e-13; Catalase OS=Helianthus annuus E-value=9e-13; Catalase-4 OS=Glycine max E-value=9e-13; Catalase-3 OS=Glycine max E-value=1e-12; Catalase-1/2 OS=Glycine max E-value=1e-12; |
| Length | 108 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGTACAGCCAGTTGGTCGCTTGGTATTGAATAGGAACATCGATAACTTCTTTGCGGAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |