Detail of EST/Unigene SRR015435.131446
Acc. SRR015435.131446
Internal Acc. EIOURYN01BXXWL
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Catharanthus roseus E-value=2e-12; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=2e-12; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-12; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase OS=Francisella tularensis subsp. tularensis (strain WY96-3418) E-value=2e-06; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase OS=Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4) E-value=2e-06;
Length 102 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGGGCTGTGAAGCTCACTCTGATGGTGACGTTTTGCTTCACTGTGTTGTTGATGCAAT
TTTGGGAGCTCTGGGGCTTCCTGATATTGGGCAGATTTTCCC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A