| Detail of EST/Unigene SRR015435.137710 |
| Acc. | SRR015435.137710 |
| Internal Acc. | EIOURYN01EGARU |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=1e-10; Chlorophyll a-b binding protein 1D (Fragment) OS=Solanum lycopersicum E-value=1e-10; Chlorophyll a-b binding protein 1C, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=1e-10; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=1e-10; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=1e-10; |
| Length | 105 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGTGCTATGTTCTCCATGTTCGAATTCTTTGTTCAAGCTATCGTCACCGGAAAGGGTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |