| Detail of EST/Unigene SRR015435.141208 |
| Acc. | SRR015435.141208 |
| Internal Acc. | EIOURYN01ER2XN |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA thiolase 2, peroxisomal OS=Arabidopsis thaliana E-value=9e-10; 3-ketoacyl-CoA thiolase 1, peroxisomal OS=Arabidopsis thaliana E-value=2e-08; 3-ketoacyl-CoA thiolase 5, peroxisomal OS=Arabidopsis thaliana E-value=2e-07; |
| Length | 102 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGGAAGATATTGATCTCTTTGAGATAAATGAGGCATTTGCATCACAATTTGTTTATTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |