Detail of EST/Unigene SRR015435.148856
Acc. SRR015435.148856
Internal Acc. EIOURYN01BS416
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 4-hydroxy-3-methylbut-2-enyl diphosphate reductase, chloroplastic OS=Arabidopsis thaliana E-value=5e-08; 4-hydroxy-3-methylbut-2-enyl diphosphate reductase, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-08; 4-hydroxy-3-methylbut-2-enyl diphosphate reductase OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=2e-06; 4-hydroxy-3-methylbut-2-enyl diphosphate reductase OS=Nostoc punctiforme (strain ATCC 29133 / PCC 73102) E-value=2e-06; 4-hydroxy-3-methylbut-2-enyl diphosphate reductase OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=2e-06;
Length 94 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGTATCCATGGTAAATATGCTCATGAGGAAACTGTTGCGACTGCATCCTTTGCTGGGA
AATACATCATTGTGAAGAACATGGCAGAGGCAAC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A