Detail of EST/Unigene SRR015435.149075
Acc. SRR015435.149075
Internal Acc. EIOURYN01BCS6U
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Cellulose synthase A catalytic subunit 6 [UDP-forming] OS=Arabidopsis thaliana E-value=4e-13; Cellulose synthase A catalytic subunit 5 [UDP-forming] OS=Arabidopsis thaliana E-value=4e-13; Probable cellulose synthase A catalytic subunit 9 [UDP-forming] OS=Arabidopsis thaliana E-value=7e-13; Cellulose synthase A catalytic subunit 2 [UDP-forming] OS=Arabidopsis thaliana E-value=2e-12; Probable cellulose synthase A catalytic subunit 6 [UDP-forming] OS=Oryza sativa subsp. japonica E-value=4e-12;
Length 106 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGTCAATACCATCAAATCTTTGAGGAAATTGTACGTAGCATATTTTCTTTCCTGAAGT
GGGGTCCATCATAAAGCACATAGCTTCTCTCAATGCCTTACTGTTA
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A