| Detail of EST/Unigene SRR015435.153982 |
| Acc. | SRR015435.153982 |
| Internal Acc. | EIOURYN01A2RCL |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Flavanone 3-dioxygenase OS=Petroselinum crispum E-value=2e-11; Naringenin,2-oxoglutarate 3-dioxygenase OS=Vitis vinifera E-value=3e-11; Naringenin,2-oxoglutarate 3-dioxygenase OS=Callistephus chinensis E-value=3e-11; Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Petunia hybrida E-value=6e-11; Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Matthiola incana E-value=6e-11; |
| Length | 98 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGTATTCGAATTCACCACTGCTTGATGATCAGCATTCTTGAACCTTCCACTGCTCAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |