Detail of EST/Unigene SRR015435.158947
Acc. SRR015435.158947
Internal Acc. EIOURYN01D8444
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Pleiotropic drug resistance protein 1 OS=Nicotiana tabacum E-value=2e-14; Pleiotropic drug resistance protein 1 OS=Nicotiana plumbaginifolia E-value=5e-13; ABC transporter G family member 40 OS=Arabidopsis thaliana E-value=1e-11; Pleiotropic drug resistance protein 4 OS=Oryza sativa subsp. japonica E-value=2e-11; Putative pleiotropic drug resistance protein 7 OS=Oryza sativa subsp. japonica E-value=1e-10;
Length 107 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGAAAAATAATATCTGACTGCAGTATAAGTAGGATTACGCCAGTATGACCAATGTTGC
TTCCAAAGGCAAGCCAGACATTGGGTCCAAAATGTTTGTGAGTATTG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A