Detail of EST/Unigene SRR015435.168449
Acc. SRR015435.168449
Internal Acc. EIOURYN01APY0A
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Cellulose synthase A catalytic subunit 3 [UDP-forming] OS=Arabidopsis thaliana E-value=1e-10; Probable cellulose synthase A catalytic subunit 8 [UDP-forming] OS=Oryza sativa subsp. japonica E-value=2e-10; Cellulose synthase A catalytic subunit 6 [UDP-forming] OS=Arabidopsis thaliana E-value=4e-10; Cellulose synthase A catalytic subunit 7 [UDP-forming] OS=Oryza sativa subsp. japonica E-value=5e-10; Probable cellulose synthase A catalytic subunit 2 [UDP-forming] OS=Oryza sativa subsp. japonica E-value=6e-10;
Length 107 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGAAGTTGGTATCAATACCAGCAAGCACTTGAGCAACCCTTGGAAGACGGCAAACAGG
TGAGCTGACACACCACCAATGACCCAAAACTGTTCATTTCTCCACCA
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A