Detail of EST/Unigene SRR015435.168625
Acc. SRR015435.168625
Internal Acc. EIOURYN01C5SG0
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Ribulose bisphosphate carboxylase small chain 1, chloroplastic OS=Solanum lycopersicum E-value=5e-10; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Stellaria longipes E-value=2e-09; Ribulose bisphosphate carboxylase small chain 8B, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-09; Ribulose bisphosphate carboxylase small chain 3B, chloroplastic OS=Solanum lycopersicum E-value=2e-09; Ribulose bisphosphate carboxylase small chain 3A/3C, chloroplastic OS=Solanum lycopersicum E-value=2e-09;
Length 111 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGTCGGTACACAAATCCGCGCTCAGTCTCGAATTCCAAGCAAGGAACCCATCCATTTT
TCAAAAGATACTCAATTTCGCTAAGCAATTAGACTCATCGGACAAGTCAGG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A