Detail of EST/Unigene SRR015435.170662

Acc.	SRR015435.170662
Internal Acc.	EIOURYN01EA1OF
Type	EST
Annotation (Top 5 hits in Uniprot_trembl)	Ribulose bisphosphate carboxylase small chain 3B, chloroplastic OS=Solanum lycopersicum E-value=6e-11; Ribulose bisphosphate carboxylase small chain 3A/3C, chloroplastic OS=Solanum lycopersicum E-value=6e-11; Ribulose bisphosphate carboxylase small chain 2A, chloroplastic OS=Solanum lycopersicum E-value=6e-11; Ribulose bisphosphate carboxylase small chain 1, chloroplastic OS=Solanum lycopersicum E-value=6e-11; Ribulose bisphosphate carboxylase small chain 3, chloroplastic OS=Solanum tuberosum E-value=8e-11;
Length	112 nt
Species	Solanum lycopersicum
Belonged EST Libraries	SRR015435;
Sequence	TCAGGATAATACGAACCCAGGCTTGTGGGTACGCCTTCTTTCGCCTCTTGAACCTCAGCC AACACCTGTGTTGCATCAGTGCACCCAAACATAGGTAACTTCCACATGGTCC
EST members of Unigene	N/A
InterProScan Domain
Gene Ontology
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene	N/A
Trichome-related Gene from Literature	N/A