Detail of EST/Unigene SRR015435.178814
Acc. SRR015435.178814
Internal Acc. EIOURYN01EDZVR
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-08; 1-deoxy-D-xylulose-5-phosphate synthase OS=Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / FAM18) E-value=4e-07; 1-deoxy-D-xylulose-5-phosphate synthase OS=Neisseria meningitidis serogroup B (strain MC58) E-value=4e-07; 1-deoxy-D-xylulose-5-phosphate synthase OS=Neisseria meningitidis serogroup A / serotype 4A (strain Z2491) E-value=4e-07; 1-deoxy-D-xylulose-5-phosphate synthase OS=Neisseria meningitidis serogroup C (strain 053442) E-value=4e-07;
Length 102 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGTCATTGTATGCATTTTAGACCTTCTTCCTTTGTTCAAGATTTTGTGTGCATATGCC
TGATGACCAACATCCCATATAATTTTATCCTCAGGAGTATAC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A