| Detail of EST/Unigene SRR015435.179149 |
| Acc. | SRR015435.179149 |
| Internal Acc. | EIOURYN01C3NPF |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Protein pleiotropic regulatory locus 1 OS=Arabidopsis thaliana E-value=2e-13; Protein pleiotropic regulator PRL2 OS=Arabidopsis thaliana E-value=4e-12; Pre-mRNA-splicing factor prp5 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=7e-10; Pre-mRNA-splicing factor prp46 OS=Neosartorya fumigata (strain ATCC MYA-4609 / Af293 / CBS 101355 / FGSC A1100) E-value=1e-08; Pre-mRNA-splicing factor prp46 OS=Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139) E-value=2e-07; |
| Length | 108 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGCCTCACTGTCCAGTGACCCAGGTTGAACAATAGTTTGAGATTGCTGGAAATTGTGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |