| Detail of EST/Unigene SRR015435.196469 |
| Acc. | SRR015435.196469 |
| Internal Acc. | EIOURYN02I5ETX |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Isopentenyl-diphosphate Delta-isomerase II OS=Clarkia xantiana E-value=6e-12; Isopentenyl-diphosphate Delta-isomerase II OS=Clarkia breweri E-value=6e-12; Isopentenyl-diphosphate Delta-isomerase I, chloroplastic OS=Arabidopsis thaliana E-value=6e-12; Isopentenyl-diphosphate Delta-isomerase I OS=Clarkia breweri E-value=1e-11; Isopentenyl-diphosphate Delta-isomerase II, chloroplastic OS=Arabidopsis thaliana E-value=1e-11; |
| Length | 102 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGCTTTGTGCAGCATTTCTTACCCCAAGAGAATTCTCCTCAATTAGCTCAGACTCTCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |