Detail of EST/Unigene SRR015435.198175
Acc. SRR015435.198175
Internal Acc. EIOURYN02H4GQ1
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Ribulose bisphosphate carboxylase small chain 3, chloroplastic OS=Solanum tuberosum E-value=5e-14; Ribulose bisphosphate carboxylase small chain 1, chloroplastic OS=Solanum lycopersicum E-value=5e-14; Ribulose bisphosphate carboxylase small chain C, chloroplastic OS=Solanum tuberosum E-value=5e-14; Ribulose bisphosphate carboxylase small chain 2A, chloroplastic OS=Solanum tuberosum E-value=7e-10; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Gossypium hirsutum E-value=2e-09;
Length 118 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGTCTAACGCGTCCACCATTGCTAGCAAGGGAGGTAATGTCAACGTTGTTGTTCTTCT
TGGTAACGGGAAAAGAAGCGGCGGATTTGAGTCCGGTGAAGGGTGCGACCATGCTAGC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A