Detail of EST/Unigene SRR015435.199630 |
Acc. | SRR015435.199630 |
Internal Acc. | EIOURYN02ICC01 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=3e-08; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Solanum lycopersicum E-value=3e-08; 15-cis-phytoene desaturase OS=Synechococcus elongatus (strain PCC 7942) E-value=6e-08; Phytoene dehydrogenase OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=8e-08; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Zea mays E-value=8e-08; |
Length | 110 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435; |
Sequence | TCAGGAAAGGTAGCTGCATGGAAAGATGATGATGGAGATTGGTACGAGACTGGTTTGCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |