| Detail of EST/Unigene SRR015435.203187 |
| Acc. | SRR015435.203187 |
| Internal Acc. | EIOURYN02HV1US |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Isopentenyl-diphosphate Delta-isomerase II OS=Camptotheca acuminata E-value=3e-12; Isopentenyl-diphosphate Delta-isomerase I, chloroplastic OS=Arabidopsis thaliana E-value=5e-12; Isopentenyl-diphosphate Delta-isomerase I OS=Camptotheca acuminata E-value=9e-12; Isopentenyl-diphosphate Delta-isomerase I OS=Clarkia breweri E-value=1e-10; Isopentenyl-diphosphate Delta-isomerase II, chloroplastic OS=Arabidopsis thaliana E-value=9e-10; |
| Length | 100 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGAAAGCTCTATGCAGCAAATTTTCAGCTTCAATCTTTTCCATTAAATGACAATTATA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |