| Detail of EST/Unigene SRR015435.207631 |
| Acc. | SRR015435.207631 |
| Internal Acc. | EIOURYN02GFFU9 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Profilin-2 OS=Glycine max E-value=3e-11; Profilin-2 OS=Malus domestica E-value=3e-11; Profilin-1 OS=Glycine max E-value=3e-11; Profilin OS=Prunus persica E-value=5e-11; Profilin OS=Chenopodium album E-value=6e-11; |
| Length | 108 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGACAACCCCAGGTTCCCCTTGAATGACCATGTACTTTGAGCCACCAAGATGCAGGCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |