Detail of EST/Unigene SRR015435.207655
Acc. SRR015435.207655
Internal Acc. EIOURYN02FVCWN
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Cellulose synthase A catalytic subunit 1 [UDP-forming] OS=Arabidopsis thaliana E-value=3e-09; Probable cellulose synthase A catalytic subunit 3 [UDP-forming] OS=Oryza sativa subsp. japonica E-value=6e-08; Probable cellulose synthase A catalytic subunit 5 [UDP-forming] OS=Oryza sativa subsp. japonica E-value=2e-07; Probable cellulose synthase A catalytic subunit 5 [UDP-forming] OS=Oryza sativa subsp. indica E-value=2e-07; Probable cellulose synthase A catalytic subunit 10 [UDP-forming] OS=Arabidopsis thaliana E-value=1e-06;
Length 106 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGACCACAAATTTGGCATATTTGGCTATTGAGAGGCTTCAAGGGTTTCGGCCCACTAT
CAGAATCATGTCGAATCCTAACCAACTCATTACGCTTGTGAGATCC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A