| Detail of EST/Unigene SRR015435.213072 |
| Acc. | SRR015435.213072 |
| Internal Acc. | EIOURYN02I48ZV |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-10; 1-deoxy-D-xylulose-5-phosphate synthase OS=Maricaulis maris (strain MCS10) E-value=8e-09; 1-deoxy-D-xylulose-5-phosphate synthase OS=Mesorhizobium sp. (strain BNC1) E-value=1e-08; 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=1e-08; 1-deoxy-D-xylulose-5-phosphate synthase 1 OS=Rhodobacter sphaeroides (strain ATCC 17023 / 2.4.1 / NCIB 8253 / DSM 158) E-value=1e-08; |
| Length | 108 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGCCTGTTTTCGGATCAAACTGTGCCACCCCATGCATTTTATCGTCTGCTGCTTCTGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |