| Detail of EST/Unigene SRR015435.21638 |
| Acc. | SRR015435.21638 |
| Internal Acc. | EIOURYN01D8QJS |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 2 OS=Glycine max E-value=4e-10; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 1 OS=Glycine max E-value=2e-09; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Brassica juncea E-value=7e-07; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=7e-07; |
| Length | 105 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGGTGTTGCCTTAGTGAAAGGTCTAGCTTGGCTAGTGTGCATCTACGGTGTGCCCCTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |