Detail of EST/Unigene SRR015435.217410
Acc. SRR015435.217410
Internal Acc. EIOURYN02ILORL
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-10; 1-deoxy-D-xylulose-5-phosphate synthase OS=Ochrobactrum anthropi (strain ATCC 49188 / DSM 6882 / NCTC 12168) E-value=2e-09; 1-deoxy-D-xylulose-5-phosphate synthase 2 OS=Rhodospirillum rubrum (strain ATCC 11170 / NCIB 8255) E-value=3e-09; 1-deoxy-D-xylulose-5-phosphate synthase 1 OS=Rhodospirillum rubrum (strain ATCC 11170 / NCIB 8255) E-value=3e-09; 1-deoxy-D-xylulose-5-phosphate synthase OS=Pelobacter carbinolicus (strain DSM 2380 / Gra Bd 1) E-value=6e-09;
Length 103 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGGTGCATGTGCCTGATGACCAACATCCCATATAATTTTATCCTCAGGAGTATCAAAA
ACATGATGCAAAGCCACAGTTAAATCCACAACACCTAAACTTG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A