Detail of EST/Unigene SRR015435.221299
Acc. SRR015435.221299
Internal Acc. EIOURYN02JB25L
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Solanum pennellii E-value=2e-14; Ribulose bisphosphate carboxylase/oxygenase activase 2, chloroplastic OS=Nicotiana tabacum E-value=3e-12; Ribulose bisphosphate carboxylase/oxygenase activase 1, chloroplastic OS=Nicotiana tabacum E-value=3e-12; Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Malus domestica E-value=2e-11; Ribulose bisphosphate carboxylase/oxygenase activase 2, chloroplastic OS=Larrea tridentata E-value=1e-10;
Length 115 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGCTCTTGAACAAGCATGTTACCATACTCAAGGAGCTTCTCAAGGGTCATTTTTGGTT
GCTCAAAAGTTGGGGGTCCATCTCTAGAGTTCAAAAGTTTTTCACCAATGAGTTC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A