Detail of EST/Unigene SRR015435.224001
Acc. SRR015435.224001
Internal Acc. EIOURYN02GU2RQ
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Cellulose synthase A catalytic subunit 1 [UDP-forming] OS=Arabidopsis thaliana E-value=2e-12; Probable cellulose synthase A catalytic subunit 1 [UDP-forming] OS=Oryza sativa subsp. japonica E-value=3e-09; Probable cellulose synthase A catalytic subunit 1 [UDP-forming] OS=Oryza sativa subsp. indica E-value=3e-09; Probable cellulose synthase A catalytic subunit 10 [UDP-forming] OS=Arabidopsis thaliana E-value=2e-08; Probable cellulose synthase A catalytic subunit 6 [UDP-forming] OS=Oryza sativa subsp. japonica E-value=7e-07;
Length 119 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGGTTTCCAACCCTCTACTCTCTCCTTCCAGTCAACACTTCCAAGCCCATAAGAATTC
AAGTCCTTTGAGGGGTCCACAATTCTTACAGGAACAGGCTCTGAGACACGCAACAGGGG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A