Detail of EST/Unigene SRR015435.2242 |
Acc. | SRR015435.2242 |
Internal Acc. | EIOURYN01ALPBK |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Isopentenyl-diphosphate Delta-isomerase I OS=Clarkia breweri E-value=3e-09; Isopentenyl-diphosphate Delta-isomerase I OS=Camptotheca acuminata E-value=3e-09; Isopentenyl-diphosphate Delta-isomerase I, chloroplastic OS=Arabidopsis thaliana E-value=3e-09; Isopentenyl-diphosphate Delta-isomerase II OS=Camptotheca acuminata E-value=6e-09; Isopentenyl-diphosphate Delta-isomerase II, chloroplastic OS=Arabidopsis thaliana E-value=4e-08; |
Length | 100 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435; |
Sequence | TCAGGGAAAAGATTGAAGCTGAAAATTTGCTGCATAGAGCTTTCAGTGTCTTTATATTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |