| Detail of EST/Unigene SRR015435.225278 |
| Acc. | SRR015435.225278 |
| Internal Acc. | EIOURYN02FPNL7 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Sulfite reductase 1 [ferredoxin], chloroplastic OS=Nicotiana tabacum E-value=4e-13; Sulfite reductase [ferredoxin], chloroplastic (Fragment) OS=Glycine max E-value=1e-12; Sulfite reductase [ferredoxin], chloroplastic OS=Arabidopsis thaliana E-value=1e-11; Sulfite reductase [ferredoxin], chloroplastic OS=Pisum sativum E-value=4e-11; Sulfite reductase [ferredoxin], chloroplastic OS=Zea mays E-value=1e-10; |
| Length | 105 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGTATCTGATGAGGATGGAGAACCTCAGGGATTCAATATATATGTAGGTGGTGGTATG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |