Detail of EST/Unigene SRR015435.230016 |
Acc. | SRR015435.230016 |
Internal Acc. | EIOURYN02H8N9B |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Petunia hybrida E-value=3e-15; Naringenin,2-oxoglutarate 3-dioxygenase OS=Arabidopsis thaliana E-value=2e-14; Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Matthiola incana E-value=6e-14; Naringenin,2-oxoglutarate 3-dioxygenase OS=Malus domestica E-value=6e-14; Naringenin,2-oxoglutarate 3-dioxygenase OS=Dianthus caryophyllus E-value=8e-14; |
Length | 118 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435; |
Sequence | TCAGAAAGTGTCCAGAGCCTGACCTTACTCTTGGGCTCAAACGACACACCGATCCAGGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |