Detail of EST/Unigene SRR015435.230310
Acc. SRR015435.230310
Internal Acc. EIOURYN02HDGJ3
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=3e-12; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=3e-12; Chlorophyll a-b binding protein of LHCII type 1 (Fragment) OS=Cucumis sativus E-value=3e-12; Chlorophyll a-b binding protein of LHCII type I, chloroplastic (Fragment) OS=Cucumis sativus E-value=3e-12; Chlorophyll a-b binding protein, chloroplastic OS=Physcomitrella patens subsp. patens E-value=3e-12;
Length 105 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGGAGGTCCACCAGCAATACGGTAACCTTCAACGGCTCCCATCAAGACAACTTGGCAA
GCCCAGATGGCCAAGATGCTCTGTGCATGGACCAAGCTTGGGTTG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A