| Detail of EST/Unigene SRR015435.230774 |
| Acc. | SRR015435.230774 |
| Internal Acc. | EIOURYN02HKBXO |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Phosphoenolpyruvate carboxylase OS=Pisum sativum E-value=4e-12; Phosphoenolpyruvate carboxylase 2 OS=Zea mays E-value=4e-12; Phosphoenolpyruvate carboxylase OS=Flaveria pringlei E-value=4e-12; Phosphoenolpyruvate carboxylase OS=Amaranthus hypochondriacus E-value=9e-12; Phosphoenolpyruvate carboxylase OS=Glycine max E-value=9e-12; |
| Length | 108 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGACCTTGCTATTTTATCACAACCCCCAGACACAATTCATGGCTCACTTCGTGTGGCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |