| Detail of EST/Unigene SRR015435.233226 |
| Acc. | SRR015435.233226 |
| Internal Acc. | EIOURYN02JDWJM |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione reductase, chloroplastic (Fragment) OS=Nicotiana tabacum E-value=5e-07; Glutathione reductase, chloroplastic/mitochondrial OS=Pisum sativum E-value=5e-07; Glutathione reductase, chloroplastic OS=Glycine max E-value=5e-07; |
| Length | 112 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGAATTTCTTCATCAAAGCCTCTCAAAACCTTCTTTTGTCGTATAAATACATGGACCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |