Detail of EST/Unigene SRR015435.246224
Acc. SRR015435.246224
Internal Acc. EIOURYN02FYTBV
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Ribulose bisphosphate carboxylase small chain 3B, chloroplastic OS=Solanum lycopersicum E-value=1e-10; Ribulose bisphosphate carboxylase small chain 3A/3C, chloroplastic OS=Solanum lycopersicum E-value=1e-10; Ribulose bisphosphate carboxylase small chain 2A, chloroplastic OS=Solanum lycopersicum E-value=1e-10; Ribulose bisphosphate carboxylase small chain 1, chloroplastic OS=Solanum lycopersicum E-value=1e-10; Ribulose bisphosphate carboxylase small chain 2C, chloroplastic OS=Solanum tuberosum E-value=3e-10;
Length 93 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGGCTAAGCAATTGCTCATCGGACAAGTCAGGAAGGTATGACAATGTCTCGTATTTCT
TCATGTTGATTGGTGGCCACACCTGCATGCATC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A