Detail of EST/Unigene SRR015435.247913 |
Acc. | SRR015435.247913 |
Internal Acc. | EIOURYN02F5593 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=7e-13; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=7e-13; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=7e-13; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=7e-13; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=7e-13; |
Length | 109 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435; |
Sequence | TCAGAGCTGTATGGTTCAAGGCTGGATCACAAATTTTCAGCGAGGGTGGACTTGACTACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |