| Detail of EST/Unigene SRR015435.24890 |
| Acc. | SRR015435.24890 |
| Internal Acc. | EIOURYN01DK57X |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chalcone synthase E OS=Ipomoea purpurea E-value=3e-12; Chalcone synthase E OS=Ipomoea nil E-value=3e-12; Chalcone synthase 2 OS=Solanum tuberosum E-value=3e-12; Chalcone synthase 2 OS=Solanum lycopersicum E-value=3e-12; Chalcone synthase OS=Vigna unguiculata E-value=4e-12; |
| Length | 107 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGCAACAAGGTTGCTTTGCTGGTGGGACCGTTATCCGACTGGCAAAGGACTTAGCTGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |