Detail of EST/Unigene SRR015435.249643 |
Acc. | SRR015435.249643 |
Internal Acc. | EIOURYN02IE193 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Allene oxide synthase, chloroplastic OS=Linum usitatissimum E-value=2e-10; Allene oxide synthase, chloroplastic OS=Arabidopsis thaliana E-value=1e-09; Allene oxide synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-09; Allene oxide synthase 2 OS=Oryza sativa subsp. japonica E-value=3e-09; Allene oxide synthase OS=Parthenium argentatum E-value=2e-08; |
Length | 127 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435; |
Sequence | TCAGAGAAAGAAGGAAGAACATCAACTTTTTCTAATTTTTCTATGGTTTGGTTCAGATGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |