Detail of EST/Unigene SRR015435.251016
Acc. SRR015435.251016
Internal Acc. EIOURYN02ILCFN
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 4-hydroxy-3-methylbut-2-enyl diphosphate reductase, chloroplastic OS=Arabidopsis thaliana E-value=2e-11; 4-hydroxy-3-methylbut-2-enyl diphosphate reductase, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-10; 4-hydroxy-3-methylbut-2-enyl diphosphate reductase OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=1e-08; 4-hydroxy-3-methylbut-2-enyl diphosphate reductase OS=Anabaena variabilis (strain ATCC 29413 / PCC 7937) E-value=1e-08; 4-hydroxy-3-methylbut-2-enyl diphosphate reductase OS=Synechococcus sp. (strain CC9605) E-value=3e-08;
Length 113 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGCTTCCCTTCCTCAAGTGGAATGTTCTTAACATCCATATCCTCTAGCCTCTTATTCA
CAGTGGGGTTGTGAATAATTTCATTAGTTATCCAAATCCTCTCTGTTGGAAAC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A