Detail of EST/Unigene SRR015435.254909
Acc. SRR015435.254909
Internal Acc. EIOURYN02GPZFX
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=4e-07; Chlorophyll a-b binding protein 151, chloroplastic OS=Gossypium hirsutum E-value=5e-07; Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=1e-06; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=1e-06; Chlorophyll a-b binding protein 25, chloroplastic OS=Petunia sp. E-value=1e-06;
Length 107 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGTCAGGGTCAGCTGAAAGCCCAGCAGTGTCCCATCCGTAGTCACCAGGGAACTCACC
AGTCAATAGCTTGGTGATTCACCAGAGAATGGGCCCAAGTACTTAAC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A