| Detail of EST/Unigene SRR015435.258106 |
| Acc. | SRR015435.258106 |
| Internal Acc. | EIOURYN02IAV8O |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chalcone synthase 2 OS=Solanum tuberosum E-value=5e-11; Chalcone synthase 2 OS=Solanum lycopersicum E-value=5e-11; Chalcone synthase OS=Casuarina glauca E-value=6e-11; Chalcone synthase 1B OS=Solanum tuberosum E-value=8e-11; Chalcone synthase 1A OS=Solanum tuberosum E-value=8e-11; |
| Length | 108 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435; |
| Sequence | TCAGGTCTAGCATCCAATCAGAAATGCCTAACGGTTGGAATGCTTCAATTAAACTCTTTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |