Detail of EST/Unigene SRR015435.258288
Acc. SRR015435.258288
Internal Acc. EIOURYN02HFPY1
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Cell division control protein 2 homolog A OS=Antirrhinum majus E-value=1e-12; Cell division control protein 2 homolog OS=Chenopodium rubrum E-value=3e-12; Cell division control protein 2 homolog (Fragment) OS=Petunia hybrida E-value=7e-12; Cell division control protein 2 homolog OS=Vigna unguiculata E-value=4e-11; Cell division control protein 2 homolog OS=Vigna aconitifolia E-value=4e-11;
Length 102 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGGGATCCTTAGAGAACTCGGGACATGAGTCCATATGCTTCTTCAAATCCAAGTCGAG
ATATTCAAACACTAGATATAATCGCTTCTCACTGTGAACCAC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A