| Acc. |
SRR015435.261609 |
| Internal Acc. |
EIOURYN02HNYAE |
| Type |
EST
|
| Annotation (Top 5 hits in Uniprot_trembl) |
Chalcone synthase 1B OS=Solanum tuberosum E-value=1e-14; Chalcone synthase 1A OS=Solanum tuberosum E-value=1e-14; Chalcone synthase 1 OS=Solanum lycopersicum E-value=1e-14; Chalcone synthase OS=Casuarina glauca E-value=3e-14; Chalcone synthase 2 OS=Solanum tuberosum E-value=3e-14; |
| Length |
111 nt |
| Species |
Solanum lycopersicum |
| Belonged EST Libraries |
SRR015435; |
| Sequence |
TCAGAAACATCGAAAAGAGCCTTCTAGAAGCATTTCAACCTCTAGGTATATCTGACTGGA
ACTCTCTATTTTGGATCGCTCACCCTGGCGGGCCTGCGATTTTGGACCAAG
|
| EST members of Unigene |
N/A
|
| InterProScan Domain |
|
| Gene Ontology |
|
| KEGG Orthology |
|
| EC |
|
| Transcription Factor Family |
|
| Transporter Classification Family |
|
| Probeset |
|
| Corresponding NCBI Gene |
N/A
|
| Trichome-related Gene from Literature |
N/A
|