Detail of EST/Unigene SRR015435.268604
Acc. SRR015435.268604
Internal Acc. EIOURYN02HQI9I
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Solanum pennellii E-value=4e-13; Ribulose bisphosphate carboxylase/oxygenase activase 2, chloroplastic OS=Nicotiana tabacum E-value=9e-12; Ribulose bisphosphate carboxylase/oxygenase activase 1, chloroplastic OS=Nicotiana tabacum E-value=3e-11; Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Arabidopsis thaliana E-value=2e-10; Ribulose bisphosphate carboxylase/oxygenase activase A, chloroplastic OS=Hordeum vulgare E-value=1e-09;
Length 110 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGCAACAGGACATTGCAAGGGGTAAGGGTCTGGTTGACAGTCTTTTCCAGGCTCCTAC
TGGTACTGGTACTCACCACGCCATCATGAATTCCTACGAATACGTCTGAG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A