Detail of EST/Unigene SRR015435.271156
Acc. SRR015435.271156
Internal Acc. EIOURYN02GF106
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Pleiotropic drug resistance protein 1 OS=Nicotiana tabacum E-value=1e-10; Pleiotropic drug resistance protein 1 OS=Nicotiana plumbaginifolia E-value=4e-10; Pleiotropic drug resistance protein 6 OS=Oryza sativa subsp. japonica E-value=7e-10; ABC transporter G family member 32 OS=Arabidopsis thaliana E-value=1e-09; Pleiotropic drug resistance protein TUR2 OS=Spirodela polyrrhiza E-value=2e-09;
Length 106 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGTCTATATCAGTAATTTTATTCTTGGAGGTCTCCGAATTGCGATACAACCAAACCAT
ACAATGTCCAGGCAACAGGATCAGCCCAATAGTACCATCTCCACCA
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A