Detail of EST/Unigene SRR015435.272531
Acc. SRR015435.272531
Internal Acc. EIOURYN02JOXGE
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Chlorophyll a-b binding protein 1C, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=5e-11; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=5e-11; Chlorophyll a-b binding protein 1A, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=3e-10; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=4e-09; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=4e-08;
Length 109 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGAAACTTGGCAACAGCCTTTCTCATGGTGATCCTTCCATTTCCAGAGATTTCTGAGG
CAGAGGGTGAGAGTTTCACTGCCTGTCCGGCAAAAGAAGGAGAAGAAAG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A