Detail of EST/Unigene SRR015435.276818 |
Acc. | SRR015435.276818 |
Internal Acc. | EIOURYN02HVBSL |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=1e-11; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 1 OS=Glycine max E-value=2e-10; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Brassica juncea E-value=2e-10; Delta(12) fatty acid dehydrogenase OS=Crepis alpina E-value=3e-09; Delta(12) fatty acid desaturase OS=Mortierella isabellina E-value=8e-09; |
Length | 102 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435; |
Sequence | TCAGGCGTGATGGCCACATTCGTGGGCATTAACCCAAATTCCAGTGCAAACACAACCCTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |